Review



paper n a plko 1 open biosystems  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 95
      Buy from Supplier

    Structured Review

    Addgene inc paper n a plko 1 open biosystems
    Paper N A Plko 1 Open Biosystems, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 174 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paper+n+a+plko+1+open+biosystems/pLKO%2E1+GFP+shRNA+(Plasmid+%2330323)/pmc06170673-781-87-110
    Average 95 stars, based on 174 article reviews
    paper n a plko 1 open biosystems - by Bioz Stars, 2026-09
    95/100 stars

    Images

    Related Articles

    shRNA:

    Article Title: Mitochondrial Stasis Reveals p62-mediated Ubiquitination in Parkin-independent Mitophagy and Mitigates Nonalcoholic Fatty Liver Disease
    Article Snippet: .. 2010 Primer Bank ID 33859506a1 shRNA targeting sequence: Rbx1 #1: TGCATCTCTCGATGGCTCAAA Sigma-Aldrich TRC clone ID: TRCN0000273778 shRNA targeting sequence: Rbx1 #2: CCACATTATGGATCTTTGTAT Sigma-Aldrich TRC clone ID: TRCN0000273726 Scrambled shRNA targeting sequence: CCTAAGGTTAAGTCGCCCTCG Sarbassov et al., Science 2005 Addgene plasmid # 1864 Recombinant DNA pSu9-GFP Eura et al., 2003 N/A Su9-mCherry-GFP This paper N/A pcDNA3.1/V5-His TOPO Invitrogen K480001 p62-MffTM This paper N/A KID p62-MffTM This paper N/A pcDNA3-HA2-ROC1 (HA-Rbx1) Ohata et al., 1999 Addgene Plasmid #19897 pSUPER-GFP This paper N/A pSUPER-GFP-Rbx1 #1 This paper N/A pSUPER-GFP-Rbx1 #2 This paper N/A pLKO.1 Open Biosystems # RHS4078 pHR-CMV8.2ΔR Stewart et al., RNA 2003 Addgene plasmid # 8455 pCMV-VSVG Stewart et al., RNA 2003 Addgene plasmid #8454 Software and Algorithms Fiji Fiji https://fiji.sc/ Open in a separate window KEY RESOURCES TABLE ..

    Sequencing:

    Article Title: Mitochondrial Stasis Reveals p62-mediated Ubiquitination in Parkin-independent Mitophagy and Mitigates Nonalcoholic Fatty Liver Disease
    Article Snippet: .. 2010 Primer Bank ID 33859506a1 shRNA targeting sequence: Rbx1 #1: TGCATCTCTCGATGGCTCAAA Sigma-Aldrich TRC clone ID: TRCN0000273778 shRNA targeting sequence: Rbx1 #2: CCACATTATGGATCTTTGTAT Sigma-Aldrich TRC clone ID: TRCN0000273726 Scrambled shRNA targeting sequence: CCTAAGGTTAAGTCGCCCTCG Sarbassov et al., Science 2005 Addgene plasmid # 1864 Recombinant DNA pSu9-GFP Eura et al., 2003 N/A Su9-mCherry-GFP This paper N/A pcDNA3.1/V5-His TOPO Invitrogen K480001 p62-MffTM This paper N/A KID p62-MffTM This paper N/A pcDNA3-HA2-ROC1 (HA-Rbx1) Ohata et al., 1999 Addgene Plasmid #19897 pSUPER-GFP This paper N/A pSUPER-GFP-Rbx1 #1 This paper N/A pSUPER-GFP-Rbx1 #2 This paper N/A pLKO.1 Open Biosystems # RHS4078 pHR-CMV8.2ΔR Stewart et al., RNA 2003 Addgene plasmid # 8455 pCMV-VSVG Stewart et al., RNA 2003 Addgene plasmid #8454 Software and Algorithms Fiji Fiji https://fiji.sc/ Open in a separate window KEY RESOURCES TABLE ..

    Plasmid Preparation:

    Article Title: Mitochondrial Stasis Reveals p62-mediated Ubiquitination in Parkin-independent Mitophagy and Mitigates Nonalcoholic Fatty Liver Disease
    Article Snippet: .. 2010 Primer Bank ID 33859506a1 shRNA targeting sequence: Rbx1 #1: TGCATCTCTCGATGGCTCAAA Sigma-Aldrich TRC clone ID: TRCN0000273778 shRNA targeting sequence: Rbx1 #2: CCACATTATGGATCTTTGTAT Sigma-Aldrich TRC clone ID: TRCN0000273726 Scrambled shRNA targeting sequence: CCTAAGGTTAAGTCGCCCTCG Sarbassov et al., Science 2005 Addgene plasmid # 1864 Recombinant DNA pSu9-GFP Eura et al., 2003 N/A Su9-mCherry-GFP This paper N/A pcDNA3.1/V5-His TOPO Invitrogen K480001 p62-MffTM This paper N/A KID p62-MffTM This paper N/A pcDNA3-HA2-ROC1 (HA-Rbx1) Ohata et al., 1999 Addgene Plasmid #19897 pSUPER-GFP This paper N/A pSUPER-GFP-Rbx1 #1 This paper N/A pSUPER-GFP-Rbx1 #2 This paper N/A pLKO.1 Open Biosystems # RHS4078 pHR-CMV8.2ΔR Stewart et al., RNA 2003 Addgene plasmid # 8455 pCMV-VSVG Stewart et al., RNA 2003 Addgene plasmid #8454 Software and Algorithms Fiji Fiji https://fiji.sc/ Open in a separate window KEY RESOURCES TABLE ..

    Recombinant:

    Article Title: Mitochondrial Stasis Reveals p62-mediated Ubiquitination in Parkin-independent Mitophagy and Mitigates Nonalcoholic Fatty Liver Disease
    Article Snippet: .. 2010 Primer Bank ID 33859506a1 shRNA targeting sequence: Rbx1 #1: TGCATCTCTCGATGGCTCAAA Sigma-Aldrich TRC clone ID: TRCN0000273778 shRNA targeting sequence: Rbx1 #2: CCACATTATGGATCTTTGTAT Sigma-Aldrich TRC clone ID: TRCN0000273726 Scrambled shRNA targeting sequence: CCTAAGGTTAAGTCGCCCTCG Sarbassov et al., Science 2005 Addgene plasmid # 1864 Recombinant DNA pSu9-GFP Eura et al., 2003 N/A Su9-mCherry-GFP This paper N/A pcDNA3.1/V5-His TOPO Invitrogen K480001 p62-MffTM This paper N/A KID p62-MffTM This paper N/A pcDNA3-HA2-ROC1 (HA-Rbx1) Ohata et al., 1999 Addgene Plasmid #19897 pSUPER-GFP This paper N/A pSUPER-GFP-Rbx1 #1 This paper N/A pSUPER-GFP-Rbx1 #2 This paper N/A pLKO.1 Open Biosystems # RHS4078 pHR-CMV8.2ΔR Stewart et al., RNA 2003 Addgene plasmid # 8455 pCMV-VSVG Stewart et al., RNA 2003 Addgene plasmid #8454 Software and Algorithms Fiji Fiji https://fiji.sc/ Open in a separate window KEY RESOURCES TABLE ..

    Software:

    Article Title: Mitochondrial Stasis Reveals p62-mediated Ubiquitination in Parkin-independent Mitophagy and Mitigates Nonalcoholic Fatty Liver Disease
    Article Snippet: .. 2010 Primer Bank ID 33859506a1 shRNA targeting sequence: Rbx1 #1: TGCATCTCTCGATGGCTCAAA Sigma-Aldrich TRC clone ID: TRCN0000273778 shRNA targeting sequence: Rbx1 #2: CCACATTATGGATCTTTGTAT Sigma-Aldrich TRC clone ID: TRCN0000273726 Scrambled shRNA targeting sequence: CCTAAGGTTAAGTCGCCCTCG Sarbassov et al., Science 2005 Addgene plasmid # 1864 Recombinant DNA pSu9-GFP Eura et al., 2003 N/A Su9-mCherry-GFP This paper N/A pcDNA3.1/V5-His TOPO Invitrogen K480001 p62-MffTM This paper N/A KID p62-MffTM This paper N/A pcDNA3-HA2-ROC1 (HA-Rbx1) Ohata et al., 1999 Addgene Plasmid #19897 pSUPER-GFP This paper N/A pSUPER-GFP-Rbx1 #1 This paper N/A pSUPER-GFP-Rbx1 #2 This paper N/A pLKO.1 Open Biosystems # RHS4078 pHR-CMV8.2ΔR Stewart et al., RNA 2003 Addgene plasmid # 8455 pCMV-VSVG Stewart et al., RNA 2003 Addgene plasmid #8454 Software and Algorithms Fiji Fiji https://fiji.sc/ Open in a separate window KEY RESOURCES TABLE ..



    Similar Products

    paper n a plko 1 open biosystems  (Addgene inc)
    95
    Addgene inc paper n a plko 1 open biosystems
    Paper N A Plko 1 Open Biosystems, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paper+n+a+plko+1+open+biosystems/pLKO%2E1+GFP+shRNA+(Plasmid+%2330323)/pmc06170673-781-87-110
    Average 95 stars, based on 1 article reviews
    paper n a plko 1 open biosystems - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier

    Image Search Results